423

submitted 1 year ago by lelgenio@lemmy.ml to c/memes@lemmy.ml

12 comments fedilink hide all child comments

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

you are viewing a single comment's thread
view the rest of the comments

[-] rusticus1773@lemmy.ml 6 points 1 year ago

Only 3 billion short

this post was submitted on 23 Jul 2023

423 points (94.3% liked)

Memes

45660 readers

1058 users here now

Be civil and nice.
Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 5 years ago

MODERATORS