423
AACGTCATAGCCTGATTACCAGTAGGTACTAG
(lemmy.ml)
An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"
If we ignore the mutations in the life of an individual, it would actually only be a few hundreds megabytes. Or if we already have a template of a human genome and we only code the difference between them and the human we want to copy, a few megabytes is enough since we all share A LOT of sequences
Wikipedia: Human genome#Information content
ya I've kind of been wondering if with how foods and random mutations affect dna I doubt you could use baby you dna to get an adult that actually looks exactly like you
There is also epigenetic modifications to be considered
Oh cool I didn't know that stuff, it's super interesting
It bottles the mind.