423

submitted 1 year ago by lelgenio@lemmy.ml to c/memes@lemmy.ml

12 comments fedilink hide all child comments

An image of Mr Krabs saying "Spanchbab me boy.I sequenced me own genome AACGTCATAGCCTGATTACCAGTAGGTACTAG"

you are viewing a single comment's thread
view the rest of the comments

[-] apotheotic@beehaw.org 7 points 1 year ago

Mr Krabs laughs very distinctly, and it sort of sounds like it would be spelt like the genome in the OP. Check it out on yt or something, should help

this post was submitted on 23 Jul 2023

423 points (94.3% liked)

Memes

45660 readers

863 users here now

Be civil and nice.
Try not to excessively repost, as a rule of thumb, wait at least 2 months to do it if you have to.

founded 5 years ago

MODERATORS