122
you are viewing a single comment's thread
view the rest of the comments
view the rest of the comments
this post was submitted on 08 Apr 2025
122 points (99.2% liked)
chapotraphouse
13878 readers
893 users here now
Banned? DM Wmill to appeal.
No anti-nautilism posts. See: Eco-fascism Primer
Slop posts go in c/slop. Don't post low-hanging fruit here.
founded 4 years ago
MODERATORS
I'm absolutely talking out of my butt now, but the US still has nukes and is OK with using them offensively. The best bet is to let a defensive war happen.
Okay do it again but this time talk out of your bidet
AAGAUUUAGUUGAGGGUGGAGAGUGGGAGGGA