122

No? We just gonna sit around and let Nazi Germany 2.0 happen? Maybe waggle your finger a bit at them? Cool. Yeah. Okay. I love our leaders, they're so commited to the freedom and wellbeing of their people.

God I wish the Red Army was here to save our asses like last time.

you are viewing a single comment's thread
view the rest of the comments
[-] WhatDoYouMeanPodcast@hexbear.net 8 points 4 months ago

AAGAUUUAGUUGAGGGUGGAGAGUGGGAGGGA

this post was submitted on 08 Apr 2025
122 points (99.2% liked)

chapotraphouse

13965 readers
656 users here now

Banned? DM Wmill to appeal.

No anti-nautilism posts. See: Eco-fascism Primer

Slop posts go in c/slop. Don't post low-hanging fruit here.

founded 4 years ago
MODERATORS