hours who up
This guy gets it
Nukes, the US surrounded by two oceans and a frigid wasteland making a full-scale invasion almost impossible, nukes, the USD being the world's reserve currency, nukes, the US's propaganda game being strong enough that there will be plenty of vassals willing to take the hit, nukes, the willingness to use nukes, nukes.
Yemen sort of is. One of only 2 good countries.
If there was a collapsing unstable nuclear armed Nazi state, I would simply get as far away as possible and not engage
Nukes and icbm. A lot of it is surrounded by water while having massive naval capabilities, THAAD systems, etc make it a pain to pull up on them. Also nukes Then the economic fallout that happens. It will get really bad really fast. Did I mention nukes? Always gonna be a pain getting into it.
I'm absolutely talking out of my butt now, but the US still has nukes and is OK with using them offensively. The best bet is to let a defensive war happen.
Okay do it again but this time talk out of your bidet
AAGAUUUAGUUGAGGGUGGAGAGUGGGAGGGA
Aside from nuke stuff, the usa also the dollar.
Yeah
Nukes exist
What, you want to live forever?
Call me a nukie if you must
nukie
As an American, I pray for front page obituaries everyday.
chapotraphouse
Banned? DM Wmill to appeal.
No anti-nautilism posts. See: Eco-fascism Primer
Slop posts go in c/slop. Don't post low-hanging fruit here.