119

No? We just gonna sit around and let Nazi Germany 2.0 happen? Maybe waggle your finger a bit at them? Cool. Yeah. Okay. I love our leaders, they're so commited to the freedom and wellbeing of their people.

God I wish the Red Army was here to save our asses like last time.

(page 2) 50 comments
sorted by: hot top controversial new old
[-] FourteenEyes@hexbear.net 21 points 5 days ago
[-] Dirt_Owl@hexbear.net 18 points 5 days ago

This guy gets it

[-] AssortedBiscuits@hexbear.net 14 points 5 days ago

Nukes, the US surrounded by two oceans and a frigid wasteland making a full-scale invasion almost impossible, nukes, the USD being the world's reserve currency, nukes, the US's propaganda game being strong enough that there will be plenty of vassals willing to take the hit, nukes, the willingness to use nukes, nukes.

[-] Formerlyfarman@hexbear.net 20 points 5 days ago

Yemen sort of is. One of only 2 good countries.

[-] bbnh69420@hexbear.net 14 points 5 days ago* (last edited 5 days ago)

If there was a collapsing unstable nuclear armed Nazi state, I would simply get as far away as possible and not engage

[-] vegeta1@hexbear.net 17 points 5 days ago* (last edited 5 days ago)

Nukes and icbm. A lot of it is surrounded by water while having massive naval capabilities, THAAD systems, etc make it a pain to pull up on them. Also nukes Then the economic fallout that happens. It will get really bad really fast. Did I mention nukes? Always gonna be a pain getting into it.

[-] ButtBidet@hexbear.net 19 points 5 days ago

I'm absolutely talking out of my butt now, but the US still has nukes and is OK with using them offensively. The best bet is to let a defensive war happen.

[-] Infamousblt@hexbear.net 8 points 5 days ago

Okay do it again but this time talk out of your bidet

AAGAUUUAGUUGAGGGUGGAGAGUGGGAGGGA

[-] boiledfrog@hexbear.net 15 points 5 days ago

Aside from nuke stuff, the usa also the dollar.

[-] sharkfucker420@lemmy.ml 15 points 5 days ago
[-] Aradino@hexbear.net 14 points 5 days ago
[-] Evilsandwichman@hexbear.net 9 points 5 days ago

What, you want to live forever?

[-] Meltyheartlove@hexbear.net 14 points 5 days ago

xi-plz possadist-ufo Call me a nukie if you must

[-] shath@hexbear.net 11 points 5 days ago
[-] LMDNW@lemm.ee 8 points 5 days ago

As an American, I pray for front page obituaries everyday.

load more comments
view more: ‹ prev next ›
this post was submitted on 08 Apr 2025
119 points (99.2% liked)

chapotraphouse

13777 readers
764 users here now

Banned? DM Wmill to appeal.

No anti-nautilism posts. See: Eco-fascism Primer

Slop posts go in c/slop. Don't post low-hanging fruit here.

founded 4 years ago
MODERATORS